PMID: 22269326

 
 100% of survey complete.
A summary of the annotations I would have probably created based on the evidence in this paper has been emailed round. Please answer the following questions by Monday 10th March so that we can evaluate to current consistency in annotation approaches and use the answers to guide the discussions in Texas

Question Title

* 1. Figure 1: Murine model of experimental abdominal aortic aneurysm: the porcine pancreatic elastase (PPE) infusion model in C57BL/6 mice
Possibly annotate porcine elastase with GO:0030198 extracellular matrix organization IDA

Would you annotate figure 1?

Question Title

* 2. Figure 3A
Cells were treated with human TGF-β1, a known regulator of miR-29b, and profibrotic stimulus. Treatment with TGF-β1 significantly decreased miR-29b expression in hAFBs but not in hASMCs.
I have created the annotation: Human TGF-β1 GO:2000628 regulation of miRNA metabolic process IDA C16: has_regulation_target human miR-29b, occurs_in CL:0002547 fibroblast of the aortic adventitia

Would you include the cell specific information in the annotation extension field associated with your annotation of TGF-β1

Question Title

* 3. Should there be a GO term specific for the miRNAs? Eg ‘miRNA activity involved in gene silencing’ with parent terms:
has_part GO:0003729 mRNA binding,
part_of GO:0035195 gene silencing by miRNA,
is_a molecular_function.
Definition: Interacting selectively and non-covalently with an RNA sequence in order to modulate translation.
Note that proteins are annotated to the term GO:0035195 gene silencing by miRNA

Question Title

* 4. To apply the GO term 'GO:0035195 gene silencing by miRNA' to a miRNA would there have to be evidence in this paper that this miRNA bound to the target mRNA?

Question Title

* 5. Figure 3B
Primary aortic fibroblasts were treated with human TGF-β1, a known regulator of miR-29b, and profibrotic stimulus.
Expression levels of miR-29b target genes (COL1A1, COL3A1, ELN, FBN1) in Tgf-β–stimulated anti-29b– and pre-29b–transfected hAFBs (compared to levels in cells not stimulated with Tgf-β) were measured. COL1A1 and COL3A1 were significantly up regulated with Tgf-β-stimulation, and further up-regulated with anti-29b treatment and significantly down regulated with pre-29b

If the anti-29b data was not available the experimental data involving the addition of pre-29b could be annotated as IDA (or IMP), for example
Human miR-29b: GO:0035195 gene silencing by miRNA IDA C16: has_ regulation_target human COL1A1 [and COL3A1] happens_during GO:0071560 cellular response to transforming growth factor beta stimulus.

As this experiment involves the addition of an miR which is known to be expressed in these cells would you also include the C16 statement: occurs_in CL:0002547 fibroblast of the aortic adventitia?

Question Title

* 6. Following on from the previous question:
Figure 3B
assuming the addition of pre-29b was annotated as:
Human miR-29b: GO:0035195 gene silencing by miRNA IDA C16: has_ regulation_target human COL1A1 [and COL3A1] happens_during GO:0071560 cellular response to transforming growth factor beta stimulus.

If the miR was not known to be expressed in fibroblast of the aortic adventitia cells would you also include the C16 statement: occurs_in CL:0002547 fibroblast of the aortic adventitia?

Question Title

* 7. Figure 5D-F demonstrates a change in MMP (matrix metalloprotease associated with ECM degradation) activity, eg (F) An increase of Mmp2 and Mmp9 expression with pre-29b treatment and a decrease of Mmp2 and Mmp9 expression with anti-29b treatment.
I would create the following annotation:
Mouse miR-29b GO:0090091 positive regulation of extracellular matrix disassembly IMP

Do you think this interpretation is too downstream from the observed increase in MMP activity?

Question Title

* 8. The custom-made LNA-anti-miR-29b 5′-3′ sequence was ACTGATTTCAAATGGTGCT and aligns 100% with both human sequences.

>hsa-mir-29b-1 MI0000105 CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG

>hsa-mir-29b-2 MI0000107 CUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCACCAUUUGAAAUCAGUGUUUUAGGAG

>Would you expect both miRs to be annotated based on the anti-29b experiments? (presumably supported with the IGI evidence code and the WITH field including the other miR sequence)

Question Title

* 9. When associating 'GO:0035195 gene silencing by miRNA' with a miRNA, based on an experiment using an anti-miR to demonstrate up-regulation of specific mRNA levels in the absence of the miR, how do we decide whether or not an mRNA is a direct target of a miRNA?

T