Screen Reader Mode Icon

Question Title

* 1. What does DNA stand for?

Question Title

* 2. What is the function of DNA?   Choose the closest answer

Question Title

* 3. Where is environmental DNA found?   Choose all correct answers.

Question Title

* 4. What are sources of environmental DNA?

Question Title

* 5. Where did we collect DNA from for our Carp Hills study?

Question Title

* 6. What animal DNA did we find in the ponds?

Question Title

* 7. When we copy this DNA string

GGCATGAGCTGGAATAATCGGAACAGCATTAAGTGTGCTAATTCGAATTGAACTAGGTCAGCCTGGCTCTATAATTGGAGATGATCAAATTTATAATGTAATTGTCACTGCCCACGCATTTGTTATAATTTTCTTCATGGTTATACCTATTATAATT

into the NCBI database (paste into the field "Enter accession number(s), gi(s), or FASTA sequence(s)") what is returned?  NCBI Database

Question Title

* 8. What type of DNA is normally used for eDNA?

0 of 8 answered
 

T