* 1. 1, Design 4 primers to amplify full length PKAalpha (sequence is shown below) by PCR. Clone PCR
product into pCDNA3.1+ vector pre-digested with EcoR1 and Xho1. An HA tag will be added to the
N-terminus of the protein. The PCR product should not be digested with EcoR1 and Xho1.
Explain your cloning strategy.

2, Design 2 primers to amplify PKAalpha. Use Gibson assembly protocol to clone PCR product into
pCDNA3.1+ pre-digested with EcoR1 and Xho1.

3, Design 2 primers to amplify PKAalpha and clone into pET28b vector pre-digested with Nde1 + Xho1.
Explain what restriction enzymes should be used to digest the PCR product.

4. After cloning into pET28b and pCDNA3.1+, what enzymes should be used to identify desired clones?






* 2. Write an SOP to transfer 40 genes per week from pDNOR221 to pEF-DEST51 vector. The final constructs must be verified and QCed.

* 3. Write an SOP for preparing Buffer A
50 mM Phosphate Buffer, pH 7.4
600 mM NaCl
10 mM imidazole
10% glycerol
0.1 mM EDTA
50 mM Arginine
5 mM 2-Mercaptoethanol

* 4. Design oligos to clone a peptide MAHHHHHH KLPVM PKKKRKV into pET28b (using Nco1 and Nde1 sites)
for E coli expression of CPP-fusion proteins. Limit oligo length to 63 nt.
You should not use restriction enzymes to digest the annealed oligos.

* 5. You designed these primers to amplify human NPR1 gene (Accession# BC063304)



You cloned the amplified product into a mammalian expression vector and sequenced the insert, the sequence is






Analyse the above sequence.
What is the next step to clone and express this gene?

* 6. Design a mammalian expression Gateway vector for cloning of 18000 human cDNA clones
for transient expression of proteins in 293EBNA1 or 293F cells. Vector requirements:

1. Very strong mammalian promoter
2. Secretion signal and Fc fusion
3. Gateway cloning
4. Use an efficient post-transcriptional regulatory element.
5. Use pCDNA3.1 or pCEP4 vector as backbone.

Describe vector construction strategy and paste final sequence below.

* 7. Design TALEN pairs targeting the CHO DHFR gene to generate DHFR-/- cell line. List target DNA
sequences (for TALEN pair only, not the entire DHFR mRNA sequence) and TALEN amino acid sequences.
Outline experimental protocol for this project.
CHO genome sequence:

genomic scaffold:

DHFR sequences: NM_001244016.1

* 8. Design oligos to synthesize C-terminal 6XHis tagged proteinase K for E coli expression


The synthetic gene should be cloned into Nde1 + Xho1 sites of pET28b vector.

* 9. You are trying to make 12 capped mRNA from plasmids purchased from a reputable cDNA clone company.
Only 3 clones from 500 bp to 2.1 kb could be amplified by PCR using Phusion DNA polymerase with HiFi buffer.
What is the next step?

* 10. You designed two primers to amplify a flu gene (NCBI Accession # is FJ966959) and clone the PCR product
to a vector to create a GFP fusion gene.

Your primers:
ctgaca CTC GAG gcc acc atgaaggcaatactagtagt tc

(ctacagtgtagaatatgtatt CGA ATT CTG CAG T)

Sequencing results:



Cloning vector MCS and GFP sequence (partial)

Please analyse the sequences and design next experiment.
After finishing this question append your name and email.

Report a problem